wu:fc43b12

Ensembl ID:
ENSDARG00000089828
ZFIN ID:
ZDB-GENE-030131-3509
Human Orthologue:
C10orf88
Human Description:
chromosome 10 open reading frame 88 [Source:HGNC Symbol;Acc:25822]
Mouse Orthologue:
2310057M21Rik
Mouse Description:
RIKEN cDNA 2310057M21 gene Gene [Source:MGI Symbol;Acc:MGI:1915527]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30665 Essential Splice Site Mutation detected in F1 DNA During 2018
sa27904 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129495 Essential Splice Site 111 364 2 6
Genomic Location (Zv9):
Chromosome 12 (position 12462975)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11318628
GRCz11 12 11356931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCGGCACCTGCCGTGGAGAGGAAGTTCAAATATCACACACTAATGGG[T/C]ATATGTATGCGAATGCTTAAGTTTACTTTACTAAACTTACTCAATTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129495 Essential Splice Site 135 364 3 6
Genomic Location (Zv9):
Chromosome 12 (position 12465304)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11320957
GRCz11 12 11359260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGGAATAATCTGATTCTGGAAAGCCCTGCTGTGTCCTGTGAGGTGAAG[G/A]TAAGAAATGTGAGAAGTAAATCCACACTTTCATTGCAGGCATTCAAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link