
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ZBTB7C
- Ensembl ID:
- ENSDARG00000089716
- Description:
- zinc finger and BTB domain containing 7C [Source:HGNC Symbol;Acc:31700]
- Human Orthologue:
- ZBTB7C
- Human Description:
- zinc finger and BTB domain containing 7C [Source:HGNC Symbol;Acc:31700]
- Mouse Orthologue:
- Zbtb7c
- Mouse Description:
- zinc finger and BTB domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2443302]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9954 | Nonsense | Available for shipment | Available now |
sa23839 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9954
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121889 | Nonsense | 97 | 610 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 3166095)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 3047558 GRCz11 21 3200737 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTGGATTTTGTGGCACCAGAATCCCTGRCGGCCATATTAGAGTTCGCCTA[C/A]ACGTCAACGCTAACAGTGACGGCATCCAACGTCAAGGAGATYCTGAGCGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23839
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121889 | Nonsense | 217 | 610 | 1 | 3 |
- Genomic Location (Zv9):
- Chromosome 21 (position 3166453)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 3045987 GRCz10 21 3047200 GRCz11 21 3199166 GRCz11 21 3200379 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGAAGCGGAAAGTCCGTCTTGCAGCTCCCAAAAAGGTCGGGATGAGTCC[C/T]AAAGATCCCAAGTGGGGTCTCCAGAAGCCCCGCAATCTGATAAACCCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: