ZBTB7C

Ensembl ID:
ENSDARG00000089716
Description:
zinc finger and BTB domain containing 7C [Source:HGNC Symbol;Acc:31700]
Human Orthologue:
ZBTB7C
Human Description:
zinc finger and BTB domain containing 7C [Source:HGNC Symbol;Acc:31700]
Mouse Orthologue:
Zbtb7c
Mouse Description:
zinc finger and BTB domain containing 7C Gene [Source:MGI Symbol;Acc:MGI:2443302]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9954 Nonsense Available for shipment Available now
sa23839 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9954
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121889 Nonsense 97 610 1 3
Genomic Location (Zv9):
Chromosome 21 (position 3166095)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3047558
GRCz11 21 3200737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATTTTGTGGCACCAGAATCCCTGRCGGCCATATTAGAGTTCGCCTA[C/A]ACGTCAACGCTAACAGTGACGGCATCCAACGTCAAGGAGATYCTGAGCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23839
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121889 Nonsense 217 610 1 3
Genomic Location (Zv9):
Chromosome 21 (position 3166453)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3045987
GRCz10 21 3047200
GRCz11 21 3199166
GRCz11 21 3200379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGCGGAAAGTCCGTCTTGCAGCTCCCAAAAAGGTCGGGATGAGTCC[C/T]AAAGATCCCAAGTGGGGTCTCCAGAAGCCCCGCAATCTGATAAACCCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link