zgc:66442

Ensembl ID:
ENSDARG00000089700
ZFIN ID:
ZDB-GENE-040426-2946
Description:
zinc finger protein 161 homolog [Source:RefSeq peptide;Acc:NP_998701]
Human Orthologue:
ZFP161
Human Description:
zinc finger protein 161 homolog (mouse) [Source:HGNC Symbol;Acc:12860]
Mouse Orthologue:
Zfp161
Mouse Description:
zinc finger protein 161 Gene [Source:MGI Symbol;Acc:MGI:1195345]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128253 Nonsense 262 442 2 3
Genomic Location (Zv9):
Chromosome 24 (position 43811649)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 42051771
GRCz11 24 41991100
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAGCCGCCCGGGTGGAGCACCGCCACCGCTGACATGAAGTTTGAGTA[T/G]CTGCTGTACGGCCACCGCGATCAGCTGGCCTGCCAGGTCTGTAGKMTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link