Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000089599
- Ensembl ID:
- ENSDARG00000089599
- Human Orthologue:
- CUZD1
- Human Description:
- CUB and zona pellucida-like domains 1 [Source:HGNC Symbol;Acc:17937]
- Mouse Orthologues:
- Cuzd1, Dmbt1
- Mouse Descriptions:
- CUB and zona pellucida-like domains 1 Gene [Source:MGI Symbol;Acc:MGI:1202881]
- deleted in malignant brain tumors 1 Gene [Source:MGI Symbol;Acc:MGI:106210]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa43026 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa23207 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43026
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000128412 | Nonsense | 116 | 586 | 2 | 10 |
- Genomic Location (Zv9):
- Chromosome 18 (position 4356868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 5106640 GRCz11 18 5721393 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAACACAAACAACCCCTACAGCAGCACCTATAATGACTACAACTACCT[T/A]GGCAACATCCAAAGCATCAACTACTTTACCACTGAGCAAAATTCCTCTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23207
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000128412 | Nonsense | 579 | 586 | 10 | 10 |
- Genomic Location (Zv9):
- Chromosome 18 (position 4360999)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 5110771 GRCz11 18 5725524 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGATTTGCGGTGTGATCTTCTACACATCCAGGACACCCGGGATCAGAAAA[C/T]AACCCTTGTCATCACACGACTTTTAAACGTGTCAGCGTTTTTTTTCCAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
