WDR77

Ensembl ID:
ENSDARG00000089591
Description:
WD repeat domain 77 [Source:HGNC Symbol;Acc:29652]
Human Orthologue:
WDR77
Human Description:
WD repeat domain 77 [Source:HGNC Symbol;Acc:29652]
Mouse Orthologue:
Wdr77
Mouse Description:
WD repeat domain 77 Gene [Source:MGI Symbol;Acc:MGI:1917715]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30440 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30440
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131000 Essential Splice Site 29 258 1 12
Genomic Location (Zv9):
Chromosome Zv9_NA232 (position 34465)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149909.1 34465
GRCz11 KN149909.1 34465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCGGCGTGTATGGATAAACACCTGGACGCCATCGACTACAGGAAAGG[T/C]GAGGATAAACAAACCCATGTGCTGTAACTGTGTAACTACTAGATTTACTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link