
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:158824
- Ensembl ID:
- ENSDARG00000089550
- ZFIN IDs:
- ZDB-GENE-000405-1, ZDB-GENE-000405-1, ZDB-GENE-070424-11, ZDB-GENE-070424-11
- Description:
- pre-B-cell leukemia homeobox 1 [Source:RefSeq peptide;Acc:NP_001077322]
- Human Orthologue:
- PBX1
- Human Description:
- pre-B-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:8632]
- Mouse Orthologue:
- Pbx1
- Mouse Description:
- pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15193 | Essential Splice Site | Available for shipment | Available now |
sa26652 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa15193
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122028 | Essential Splice Site | 17 | 275 | 3 | 9 |
ENSDART00000125538 | Essential Splice Site | 88 | 429 | 3 | 10 |
ENSDART00000129503 | Essential Splice Site | 88 | 429 | 3 | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 2168031)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 2193527 GRCz11 6 2371896 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TGGGATRTTGGAGCWGTGTCAGTAATCTTYCTCTGTTTGCTTTGTGTTTT[A/C]GTGTTGAGTATCCGTGGAGCTCAGGAGGAGGAGCCTCCCGACGCTCAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa26652
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122028 | Nonsense | 166 | 275 | 5 | 9 |
ENSDART00000125538 | Nonsense | 237 | 429 | 5 | 10 |
ENSDART00000129503 | Nonsense | 237 | 429 | 5 | 9 |
- Genomic Location (Zv9):
- Chromosome 6 (position 2177908)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 2183735 GRCz11 6 2381688 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCTGATTTCTCTCTCTCTCTCTCTCGCTCTCTTCACAGGAGGAAAAGA[C/T]GAAACTTCAACAAACAGGCCACAGAGATCCTGAATGAGTATTTTTACTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
- Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: