zgc:158824

Ensembl ID:
ENSDARG00000089550
ZFIN IDs:
ZDB-GENE-000405-1, ZDB-GENE-000405-1, ZDB-GENE-070424-11, ZDB-GENE-070424-11
Description:
pre-B-cell leukemia homeobox 1 [Source:RefSeq peptide;Acc:NP_001077322]
Human Orthologue:
PBX1
Human Description:
pre-B-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:8632]
Mouse Orthologue:
Pbx1
Mouse Description:
pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15193 Essential Splice Site Available for shipment Available now
sa26652 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122028 Essential Splice Site 17 275 3 9
ENSDART00000125538 Essential Splice Site 88 429 3 10
ENSDART00000129503 Essential Splice Site 88 429 3 9
Genomic Location (Zv9):
Chromosome 6 (position 2168031)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2193527
GRCz11 6 2371896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGGATRTTGGAGCWGTGTCAGTAATCTTYCTCTGTTTGCTTTGTGTTTT[A/C]GTGTTGAGTATCCGTGGAGCTCAGGAGGAGGAGCCTCCCGACGCTCAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26652
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122028 Nonsense 166 275 5 9
ENSDART00000125538 Nonsense 237 429 5 10
ENSDART00000129503 Nonsense 237 429 5 9
Genomic Location (Zv9):
Chromosome 6 (position 2177908)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2183735
GRCz11 6 2381688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTGATTTCTCTCTCTCTCTCTCTCGCTCTCTTCACAGGAGGAAAAGA[C/T]GAAACTTCAACAAACAGGCCACAGAGATCCTGAATGAGTATTTTTACTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Breast cancer (prognosis): Identification of inherited genetic variations influencing prognosis in early-onset breast cancer. (View Study)
  • Weight: Genome-wide association study of anthropometric traits and evidence of interactions with age and study year in Filipino women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link