zgc:92594

Ensembl ID:
ENSDARG00000089517
ZFIN ID:
ZDB-GENE-040718-482
Description:
hypothetical protein LOC436996 [Source:RefSeq peptide;Acc:NP_001002723]
Human Orthologues:
TRIM16, TRIM16L, TRIM25, TRIM29, TRIM47, TRIM8
Human Descriptions:
tripartite motif-containing 16 [Source:HGNC Symbol;Acc:17241]
tripartite motif-containing 16-like [Source:HGNC Symbol;Acc:32670]
tripartite motif-containing 25 [Source:HGNC Symbol;Acc:12932]
tripartite motif-containing 29 [Source:HGNC Symbol;Acc:17274]
tripartite motif-containing 47 [Source:HGNC Symbol;Acc:19020]
tripartite motif-containing 8 [Source:HGNC Symbol;Acc:15579]
Mouse Orthologues:
4933422H20Rik, Trim16, Trim25, Trim29, Trim47, Trim8
Mouse Descriptions:
RIKEN cDNA 4933422H20 gene Gene [Source:MGI Symbol;Acc:MGI:3588186]
tripartite motif-containing 16 Gene [Source:MGI Symbol;Acc:MGI:2137356]
tripartite motif-containing 25 Gene [Source:MGI Symbol;Acc:MGI:102749]
tripartite motif-containing 29 Gene [Source:MGI Symbol;Acc:MGI:1919419]
tripartite motif-containing 47 Gene [Source:MGI Symbol;Acc:MGI:1917374]
tripartite motif-containing 8 Gene [Source:MGI Symbol;Acc:MGI:1933302]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41093 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128137 Essential Splice Site 237 437 2 6
Genomic Location (Zv9):
Chromosome 7 (position 76834172)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 73609977
GRCz11 7 73833141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAGCGCAACAAACAGGAGCAAACGGAGATCGAGAGACACGCAAAG[G/A]TGAAAACAGTAGTGAAGTCATTAGTTATTTTCTTTTTATATATATATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link