ugt1b4

Ensembl ID:
ENSDARG00000089507
ZFIN IDs:
ZDB-GENE-080227-10, ZDB-GENE-080227-11, ZDB-GENE-080227-12, ZDB-GENE-080227-13, ZDB-GENE-080227-14, ZDB-GENE-080227-15
Description:
UDP glucuronosyltransferase 1 family, polypeptide B7 precursor [Source:RefSeq peptide;Acc:NP_001166
Human Orthologues:
UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
Human Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
Mouse Orthologues:
Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
Mouse Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35115 Nonsense Mutation detected in F1 DNA During 2018
sa35116 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35115
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122424   None 542 None 5
ENSDART00000123244   None 535 None 5
ENSDART00000126815   None 528 None 5
ENSDART00000127075   None 529 None 5
ENSDART00000127797   None 531 None 5
ENSDART00000128276 Nonsense 187 533 1 5
Genomic Location (Zv9):
Chromosome 11 (position 31182619)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30059981
GRCz11 11 30307165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACCTATCTGTGCCTGCAGTGTACATGCTAAGAGGAATAATGTGTGAAT[C/A]GAAAGCCACAGCGTGTCCGAACCCACCCTCTTATATTCCACGTTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122424 Essential Splice Site 376 542 3 5
ENSDART00000123244 Essential Splice Site 369 535 3 5
ENSDART00000126815 Essential Splice Site 362 528 3 5
ENSDART00000127075 Essential Splice Site 363 529 3 5
ENSDART00000127797 Essential Splice Site 365 531 3 5
ENSDART00000128276 Essential Splice Site 367 533 3 5
Genomic Location (Zv9):
Chromosome 11 (position 31199847)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30077209
GRCz11 11 30324393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTGAAAATGTCAAACTGATGAAATGGCTTCCACAGAATGACTTGCTTG[G/T]TGAGTTTTTTTTTTTTTTAGATGCTTAGCTTGCATTCTTCTATGCAATGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link