
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000089494
- Ensembl ID:
- ENSDARG00000089494
- Human Orthologue:
- RNF213
- Human Description:
- ring finger protein 213 [Source:HGNC Symbol;Acc:14539]
- Mouse Orthologue:
- Rnf213
- Mouse Description:
- ring finger protein 213 Gene [Source:MGI Symbol;Acc:MGI:1289196]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44412 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa44412
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000121423 | Essential Splice Site | 197 | 338 | 6 | 8 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA510 (position 10159)
- Other Location(s):
-
Assembly Chromosome Position GRCz11 3 56773733 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GATTTTATTGAAATGAATAAATATACAAACCACTGTTTCTCATCCCTTCA[G/T]GGAGAGACCGCAGGTTCTTGACTAAGGCCCTTTCGCCTTTTGATGACTCT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Lipoprotein-associated phospholipase A2 activity change in response to statin therapy: Genome-wide association study evaluating lipoprotein-associated phospholipase A2 mass and activity at baseline and after rosuvastatin therapy. (View Study)
- Moyamoya disease: A genome-wide association study identifies RNF213 as the first Moyamoya disease gene. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: