tmem176l.2

Ensembl ID:
ENSDARG00000089399
ZFIN ID:
ZDB-GENE-080829-12

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28739 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28739
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122584 Missense 226 244 6 6
ENSDART00000131485 Essential Splice Site 224 241 None 8

The following transcripts of ENSDARG00000089399 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 49758977)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 46673369
GRCz11 16 46640085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCTTGATTATTTCTGTGTGTTTATGTTATTTTTTTGTGTGGGATTTAC[A/T]GGAGGATCTAGAACATGGAAAGCCACTTCTGGATGATGACATTGCTGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link