wu:fj49c06

Ensembl ID:
ENSDARG00000089371
ZFIN ID:
ZDB-GENE-030131-8063

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28516 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28516
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124612 Nonsense 61 558 2 6
Genomic Location (Zv9):
Chromosome 15 (position 36666943)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 38066947
GRCz11 15 37968532
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACACATTATACCCACCTAAAAACCCACGTAGGATTGTGTGGTATCAGTG[G/A]GACTCTATGCATTATCCTTTAGTCTATGATCCATGGTATCCAAATGATGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link