zgc:113131

Ensembl ID:
ENSDARG00000089357
ZFIN ID:
ZDB-GENE-050320-135
Description:
Protein FAM73B [Source:UniProtKB/Swiss-Prot;Acc:Q5BLE2]
Human Orthologue:
FAM73B
Human Description:
family with sequence similarity 73, member B [Source:HGNC Symbol;Acc:23621]
Mouse Orthologue:
Fam73b
Mouse Description:
family with sequence similarity 73, member B Gene [Source:MGI Symbol;Acc:MGI:1922035]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29498 Nonsense Mutation detected in F1 DNA During 2018
sa12133 Nonsense Available for shipment Available now
sa37215 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa29498
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 266 565 7 14
Genomic Location (Zv9):
Chromosome 21 (position 4307108)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3707727
GRCz11 21 3870737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGTGACTTCAACTGTATGTGATGTCACTTCCCTTTCTGGTTTTGCAGT[T/A]GTTTGAGACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCGGCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 285 565 7 14
Genomic Location (Zv9):
Chromosome 21 (position 4307050)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3707785
GRCz11 21 3870795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCRGCCGCTCTCTA[T/A]GAAGAAGCTCTGASTTTGGTGAAAGATGGAGACGTGGCCTGCAGATCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 492 565 14 14
Genomic Location (Zv9):
Chromosome 21 (position 4297138)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3717690
GRCz11 21 3880700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATAAAGCGACCCTTGAGCTAATATCCCATTCTCCTTTACTCTCCACAG[C/T]AACAGATTGTTCAGTATCTGAAGGACATGTTTGACCATGATAAGGTGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link