zp3.2

Ensembl ID:
ENSDARG00000089352
ZFIN IDs:
ZDB-GENE-050626-121, ZDB-GENE-991129-7
Description:
zona pellucida glycoprotein 3.2 [Source:RefSeq peptide;Acc:NP_001020357]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42845 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42844 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074173 Essential Splice Site 213 427 2 8
Genomic Location (Zv9):
Chromosome 17 (position 2367256)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2412901
GRCz11 17 2589287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCCGCACTGATGGTGCAGTTGTTGGTGTTCAGTGCCACTATCCAAGG[T/C]ACATTAACGTCTTCGGTGCTTAATACAACAGGGTAAACCACTTCGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074173 Nonsense 360 427 6 8
Genomic Location (Zv9):
Chromosome 17 (position 2365790)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2411435
GRCz11 17 2587821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCCTGCAGATCTACATTACATGCATTGTGAGGGCCACTGTTGCTGCC[A/T]GACATAGTGACCATCTGCACAAGTCCTGCTCCTTTGCCAATGGGTATGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link