
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000089319
- Ensembl ID:
- ENSDARG00000089319
- Human Orthologues:
- ANKK1, RIPK1, RIPK3, RIPK4
- Human Descriptions:
- ankyrin repeat and kinase domain containing 1 [Source:HGNC Symbol;Acc:21027]
- receptor (TNFRSF)-interacting serine-threonine kinase 1 [Source:HGNC Symbol;Acc:10019]
- receptor-interacting serine-threonine kinase 3 [Source:HGNC Symbol;Acc:10021]
- receptor-interacting serine-threonine kinase 4 [Source:HGNC Symbol;Acc:496]
- Mouse Orthologues:
- Ankk1, Ripk1, Ripk3, Ripk4
- Mouse Descriptions:
- ankyrin repeat and kinase domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3045301]
- receptor (TNFRSF)-interacting serine-threonine kinase 1 Gene [Source:MGI Symbol;Acc:MGI:108212]
- receptor-interacting serine-threonine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2154952]
- receptor-interacting serine-threonine kinase 4 Gene [Source:MGI Symbol;Acc:MGI:1919638]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa8769 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8480 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa34083 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa8769
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130097 | Nonsense | 29 | 513 | 1 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 29994306)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 28386829 GRCz11 7 28658022 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GAAGGACCTGCGAGATGTAGTTCTGGTGAGAACGAGCGTAGGCGCCTGTT[T/A]GCGAGGACATTTCGGGAGAACTGGRGGCAAAGTGGCTGTCAAGTTAATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8480
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130097 | Nonsense | 60 | 513 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 29993839)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 28386362 GRCz11 7 28657555 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- NNNNNTTCTTTTCAGTAAATGGATTGACAGGTTAAAGAGAGCAGGGATGT[T/A]GGRGCAGGTGTGTTGCGAGCAAGTACTCRTCCCGCTGGGTGTGTGCMMAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34083
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130097 | Nonsense | 85 | 513 | 2 | 11 |
- Genomic Location (Zv9):
- Chromosome 7 (position 29993764)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 7 28386287 GRCz11 7 28657480 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTCATCCCGCTGGGTGTGTGCACATCACACTCTCTAGTTGGTCTGGTTT[G/A]GGATTGGATGCCTGAAGGATCTCTAGATTCTCTGCTGCATGAGGTAAGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: