si:dkey-240n22.6

Ensembl ID:
ENSDARG00000089296
ZFIN ID:
ZDB-GENE-070705-411
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5A3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20317 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20317
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129607 Nonsense 391 965 2 7
ENSDART00000136192   None 243 None 3
Genomic Location (Zv9):
Chromosome 4 (position 60888472)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75369271
GRCz11 4 76946009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCTATGAGAGCGATCTGAAAGACTGTGGCATTGACGTCTATAAGGCAT[C/A]GGTGTACTCTGGCATGTGTACCCAGATCTTTAAGGAGGAGACGGGAATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link