LPHN1 (1 of 4)

Ensembl ID:
ENSDARG00000089292
Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45156 Essential Splice Site Mutation detected in F1 DNA During 2018
sa40154 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20133 Nonsense Available for shipment Available now
sa40153 Nonsense Mutation detected in F1 DNA During 2018
sa26145 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33299 Nonsense Mutation detected in F1 DNA During 2018
sa33298 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 11 1474 2 30
Genomic Location (Zv9):
Chromosome 3 (position 48834061)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50834954
GRCz11 3 47646454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGATTAGGACACATGAGAGTTGCTTTTCTATTCTGGAGGCTTGCGTTA[G/A]GTTGGTGGATGGCAGCCGGAGAAGAGCTGTGTGAAAGAGTGGGAGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 96 1474 3 30
Genomic Location (Zv9):
Chromosome 3 (position 48832653)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50833546
GRCz11 3 47645046
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAATGTACAGTGCTACCTACCAGACGCCTTCAAGATCATGTCACAGAGG[T/C]ACACCAGAGCACTGTTCTGCTGCAGGATCTATTTTTGTGGTGGTTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20133
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 144 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760990)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761883
GRCz11 3 47573377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTTCCACATCTCCAGTCTTTGTATGTCCTGGGACTCTAT[T/A]AAGGGTGCAGGCAGCAAGTTTGCTGCAGGAGGCGGAGCATCAGTCGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 197 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760832)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761725
GRCz11 3 47573219
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTACCGCACAGATATGCTGTACGAGTATGCTTCATGGGAAGACTTCAAG[C/T]AGAATCGAGCCACAACCACCTACAAGTGAGTGACGATCTTAGTGTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 205 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760806)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761699
GRCz11 3 47573193
KASP Assay ID:
2259-4070.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCTTCATGGGAAGACTTCAAGCAGAATCGAGCCACAACCACCTACAA[G/T]TGAGTGACGATCTTAGTGTTAGGAACCAATGACCATCTCTGTGGATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33299
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 376 1474 7 30
Genomic Location (Zv9):
Chromosome 3 (position 48759868)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50760761
GRCz11 3 47572255
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCCTTCCCCAATCCATACCAGTATGTGTCTTCTGTGGACTACAACCCA[C/T]GAGACAATCAACTTTATGTCTGGAATAACTACAATGTACTGCGCTACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33298
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 561 1474 10 30
Genomic Location (Zv9):
Chromosome 3 (position 48753139)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50754032
GRCz11 3 47563619
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAGCCCTTATTTTCTGTCCTGCCGCTGTACCGCTACCTCAGCTATTA[T/A]CATTCCGGCCTCAGCTCACATTACAGCACACAGGTCATTCCTCTGACATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Mortality among heart failure patients: Genomic variation associated with mortality among adults of European and African ancestry with heart failure: the cohorts for heart and aging research in genomic epidemiology consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link