zgc:162193

Ensembl ID:
ENSDARG00000089286
ZFIN ID:
ZDB-GENE-030131-2035
Description:
Protein FAM115 [Source:UniProtKB/Swiss-Prot;Acc:A4IG42]
Human Orthologues:
FAM115A, FAM115C
Human Descriptions:
family with sequence similarity 115, member A [Source:HGNC Symbol;Acc:22201]
family with sequence similarity 115, member C [Source:HGNC Symbol;Acc:26878]
Mouse Orthologues:
Eapa2, Fam115a, Fam115c
Mouse Descriptions:
experimental autoimmune prostatitis antigen 2 Gene [Source:MGI Symbol;Acc:MGI:3042585]
family with sequence similarity 115, member A Gene [Source:MGI Symbol;Acc:MGI:1914665]
family with sequence similarity 115, member C Gene [Source:MGI Symbol;Acc:MGI:2385258]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16829 Nonsense Available for shipment Available now
sa17361 Nonsense Available for shipment Available now
sa22598 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16829
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127026 Nonsense 102 912 2 8
Genomic Location (Zv9):
Chromosome 15 (position 13988016)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14273695
GRCz11 15 14209652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGAGATGCTGGAGTTGTAGGGATTCAGAAAAGTTTACGAACWGTAGCT[G/T]AAAACTTGAACTAYAGCCCTTTCAAGACAGAACTAGGAGACTTTCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17361
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127026 Nonsense 423 912 3 8
Genomic Location (Zv9):
Chromosome 15 (position 13989077)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14272634
GRCz11 15 14208591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTTGTAAACATGGGTACCACTTTCGMAGCATGCTGCAGAGATTTGCT[C/T]AGCATGTAAGCCAAGGGCAAGAGCTGACTGATCGRGAACAGGGCTGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127026 Nonsense 436 912 3 8
Genomic Location (Zv9):
Chromosome 15 (position 13989116)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 14272595
GRCz11 15 14208552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATTTGCTCAGCATGTAAGCCAAGGGCAAGAGCTGACTGATCGAGAA[C/T]AGGGCTGTTTGAAGCAGCTGGGCACTGACTGTGCCAGTTACCTTCAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link