wu:fc76b11

Ensembl ID:
ENSDARG00000089243
ZFIN ID:
ZDB-GENE-030131-4156
Human Orthologue:
C10orf28
Human Description:
chromosome 10 open reading frame 28 [Source:HGNC Symbol;Acc:23512]
Mouse Orthologue:
D19Ertd386e
Mouse Description:
DNA segment, Chr 19, ERATO Doi 386, expressed Gene [Source:MGI Symbol;Acc:MGI:1196316]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25688 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25688
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122551 Nonsense 54 338 1 7
Genomic Location (Zv9):
Chromosome 1 (position 55489933)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 54272872
GRCz11 1 54950523
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGACAAACCTCAGTCAGACGGTGACAAGAAATCCAAACCCAGACCT[C/T]GATACACAGATAAAGCCCGCAAGAACAAGAAAGATAAAGCCAAAGTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link