wu:fc54b01

Ensembl ID:
ENSDARG00000089232
ZFIN ID:
ZDB-GENE-030131-3785
Human Orthologue:
PRR14
Human Description:
proline rich 14 [Source:HGNC Symbol;Acc:28458]
Mouse Orthologue:
Prr14
Mouse Description:
proline rich 14 Gene [Source:MGI Symbol;Acc:MGI:2384565]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5210 Nonsense F2 line generated During 2018
sa20055 Nonsense Available for shipment Available now
sa15244 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5210
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122228 Nonsense 360 1067 3 7
Genomic Location (Zv9):
Chromosome 3 (position 32985365)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32716675
GRCz11 3 32848389
KASP Assay ID:
554-3556.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTGGATGTGGAGATGAAGGAATCACGGTCTGAAAACAGTAAAGAGTG[T/A]GCAGACTACTTGTCTGGAATATCAGACCCTCCAAAGAACACTTCTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20055
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122228 Nonsense 702 1067 3 7
Genomic Location (Zv9):
Chromosome 3 (position 32986389)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32717699
GRCz11 3 32849413
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCATTTACCCCGGTGCCACACACATGACAGCAGCACTACCTCACGCAGC[A/T]GAAAGAGCTTACCCGCTCCACTTCCCATCCACCATCATTCACCGTCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15244
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122228 Nonsense 829 1067 3 7
Genomic Location (Zv9):
Chromosome 3 (position 32986770)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32718080
GRCz11 3 32849794
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTTCCCCCCTTACCTCCACCCYCACGTCCTGTCATGYTTTTACCGGC[C/T]AATCCTCTGTTGTCACTCCCAGCCCCGAGACACCTTCTGCCTCTGTGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link