wu:fd44f01

Ensembl ID:
ENSDARG00000089230
ZFIN ID:
ZDB-GENE-030131-4633

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10697 Nonsense Available for shipment Available now
sa18107 Nonsense Available for shipment Available now
sa9904 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10697
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129955 Nonsense 85 386 2 3
Genomic Location (Zv9):
Chromosome 11 (position 7071011)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6974224
GRCz11 11 6984063
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGAAGGTGAAGTCACGCAAGCTCCCTTGGCTTYAGACATCTCAGAAATA[C/T]GAGTAAAGATGGAGGTTGCTGCTGTACCAATGAGCAATGCTTCGACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18107
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129955 Nonsense 169 386 2 3
Genomic Location (Zv9):
Chromosome 11 (position 7070757)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6973970
GRCz11 11 6983809
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTCATACTCTGCTGCAGTGGAGGTTTGCATCGATTCCCARACTGAATA[T/A]CCAGCACCTCAACAAGATCCMACGYCTTTTCCACTTTACACTGAGACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129955 Nonsense 309 386 3 3
Genomic Location (Zv9):
Chromosome 11 (position 7067848)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 6971061
GRCz11 11 6980900
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYGGGAATTATCCTTTCTACTGCAAGGTATGCGACAGRCCTTTCAGACGT[C/T]AAAAGAGCATGCAAAACCACATGCTTTTRCACCAGGATGAGCGAAACTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link