wu:fc41e04

Ensembl ID:
ENSDARG00000089207
ZFIN ID:
ZDB-GENE-031118-182
Human Orthologue:
ANKRD27
Human Description:
ankyrin repeat domain 27 (VPS9 domain) [Source:HGNC Symbol;Acc:25310]
Mouse Orthologue:
Ankrd27
Mouse Description:
ankyrin repeat domain 27 (VPS9 domain) Gene [Source:MGI Symbol;Acc:MGI:2444103]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44360 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124347 Nonsense 322 623 10 17
Genomic Location (Zv9):
Chromosome 25 (position 37458219)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35871865
GRCz11 25 36421584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGCATCGAGTCCATGTGTGCCGATGATCTGCTGTTGGTCATTCTGTA[T/A]CTGCTCATCAAGACAGAAATTCCCAACTGGTGAGTGAAGGGCTTTATTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Major depressive disorder: Common genetic variation and antidepressant efficacy in major depressive disorder: a meta-analysis of three genome-wide pharmacogenetic studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link