
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000089205
- Ensembl ID:
- ENSDARG00000089205
- Human Orthologues:
- RDH11, RDH12
- Human Descriptions:
- retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
- retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
- Mouse Orthologues:
- Rdh11, Rdh12
- Mouse Descriptions:
- retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
- retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa37860 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa25212 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa37860
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126928 | Nonsense | 53 | 314 | 3 | 8 |
- Genomic Location (Zv9):
- Chromosome 24 (position 19025114)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 18331590 GRCz11 24 18476009 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGATGGAAAAACTGCTATAGTGACTGGAGCAAACACTGGGATTGGGAAA[G/T]AAACAGCGAAGGACCTTGCAAATCGGGGTAGGTAACGTAGCCAAACATTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25212
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126928 | Nonsense | 225 | 314 | 7 | 8 |
- Genomic Location (Zv9):
- Chromosome 24 (position 19019993)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 24 18326469 GRCz11 24 18470888 - KASP Assay ID:
- 554-7881.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCAAGATTATTATAATTTTTTCTGTGGTAGAGCTGGGAGTGAGGGTTTA[T/A]GCTGTGGATCCAGGCCTGGTGAATACAGATATCACCAGACATTTGATGAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: