zgc:92020

Ensembl ID:
ENSDARG00000089156
ZFIN ID:
ZDB-GENE-040718-394
Description:
early growth response protein 3 [Source:RefSeq peptide;Acc:NP_001002647]
Human Orthologue:
EGR3
Human Description:
early growth response 3 [Source:HGNC Symbol;Acc:3240]
Mouse Orthologue:
Egr3
Mouse Description:
early growth response 3 Gene [Source:MGI Symbol;Acc:MGI:1306780]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7160 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21390 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7160
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127062 Essential Splice Site 51 422 1 2
Genomic Location (Zv9):
Chromosome 8 (position 52993017)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50738905
GRCz11 8 50727551
KASP Assay ID:
554-5431.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTTCRCAAACCCGGACTCCATTTCGCACTACTCGCAGATGAATACAG[G/A]TRAGGAGGAAAGCAAAAGTTTTAGAGTYAAGCTGTTGTTGGAGTTTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21390
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127062 Nonsense 241 422 2 2
Genomic Location (Zv9):
Chromosome 8 (position 52996614)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 50742502
GRCz11 8 50731148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAACCATGGACCCTATCAGGGTGAACCCGCCTCCCATAACTCCCCTC[G/T]AGACCATTCGAGCTTTTAAGGATAAGCAGCAGATTCATCCCGGCTTCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link