si:ch1073-440b2.1

Ensembl ID:
ENSDARG00000089138
ZFIN ID:
ZDB-GENE-030131-8303
Human Orthologue:
LONRF2
Human Description:
LON peptidase N-terminal domain and ring finger 2 [Source:HGNC Symbol;Acc:24788]
Mouse Orthologue:
Lonrf2
Mouse Description:
LON peptidase N-terminal domain and ring finger 2 Gene [Source:MGI Symbol;Acc:MGI:1920209]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25590 Essential Splice Site Mutation detected in F1 DNA During 2018
sa32691 Nonsense Mutation detected in F1 DNA During 2018
sa32690 Nonsense Mutation detected in F1 DNA During 2018
sa39626 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25590
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129204 Essential Splice Site 116 488 3 11
ENSDART00000148175   None 157 None 3
Genomic Location (Zv9):
Chromosome 1 (position 27488740)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27734827
GRCz11 1 28428541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTAATACCATTATTCCTAGAGATGGAACCAAAGCAGGCTGTTCGAAGG[T/G]TACTGTATGATTTAACCATGATTTAACATATACAACAGGGCTACCAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129204 Nonsense 247 488 7 11
ENSDART00000148175   None 157 None 3
Genomic Location (Zv9):
Chromosome 1 (position 27482757)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27728844
GRCz11 1 28422558
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAACATATCTTTCTTTTTTTGCAGTATCTGGCCACTAGAGCGTACTGC[A/T]AAACTCTTCTAATTGAAGAACTATTGCAGCAGTACTTGAGTGATGAACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32690
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129204 Nonsense 298 488 8 11
ENSDART00000148175   None 157 None 3
Genomic Location (Zv9):
Chromosome 1 (position 27465257)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27711344
GRCz11 1 28405058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGAAGTTCCCATCTTTGTTTGCACCATGGCATTTCCTACCATTCCCTG[T/A]CCACTGCATGTGTTTGAGCCTCGATACAGGCTTATGATTCGCAGATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39626
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129204 Nonsense 314 488 8 11
ENSDART00000148175   None 157 None 3
Genomic Location (Zv9):
Chromosome 1 (position 27465210)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 27711297
GRCz11 1 28405011
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTCCACTGCATGTGTTTGAGCCTCGATACAGGCTTATGATTCGCAGAT[C/A]ATTGGAAACAGGGACCAAACAGTTTGGCATGTGTATTGCTGATGAACTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link