taar12f

Ensembl ID:
ENSDARG00000089074
ZFIN IDs:
ZDB-GENE-041014-98, ZDB-GENE-070424-254
Description:
trace amine associated receptor 12f [Source:RefSeq peptide;Acc:NP_001076376]
Human Orthologue:
TAAR2
Human Description:
trace amine associated receptor 2 [Source:HGNC Symbol;Acc:4514]
Mouse Orthologues:
Taar2, Taar3
Mouse Descriptions:
trace amine-associated receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2685071]
trace amine-associated receptor 3 Gene [Source:MGI Symbol;Acc:MGI:3527427]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37152 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa37152
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121820 Nonsense 211 331 2 2
ENSDART00000125315 Nonsense 199 335 1 2
ENSDART00000131057 Nonsense 203 337 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46251608)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46170365
GRCz11 20 46074085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGGGAAATTGTGTTCTGTATTTTAACAAACAATGGGGTCTTATATG[T/A]CCAATTCTCACATTCTTTCTTCCCGGGACAATCATGAGCTCTCTGTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link