zgc:103540

Ensembl ID:
ENSDARG00000089062
ZFIN ID:
ZDB-GENE-040912-33
Description:
hypothetical protein LOC447870 [Source:RefSeq peptide;Acc:NP_001004609]
Human Orthologue:
CCNB1
Human Description:
cyclin B1 [Source:HGNC Symbol;Acc:1579]
Mouse Orthologue:
Ccnb1
Mouse Description:
cyclin B1 Gene [Source:MGI Symbol;Acc:MGI:88302]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43186 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43186
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123346 Nonsense 244 364 6 9
Genomic Location (Zv9):
Chromosome 18 (position 49493419)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCGTACTCATGTGGAGACGTACGGCGCATGGAGAGGATCATCCTCAAA[C/T]GACTCGACTACAGCCTCGGACGACCCAACCCGCTGCACTTTCTGCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link