LOC100332723

Ensembl ID:
ENSDARG00000089023

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25443 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa45863 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25443
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126980 Splice Site, Nonsense 487 778 10 18
Genomic Location (Zv9):
Chromosome Zv9_NA447 (position 6366)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150189.1 6366
GRCz11 KN150189.1 6366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGTCAACTACACCGATCCCTCAGAACCGTGCTGCAGCAAACAAGTCTG[C/A]AGTAAGACAAGTTTGACAGTTTCCAAAGAGACTAACTTCAGGTTTGCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45863
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126980 Essential Splice Site 665 778 16 18
Genomic Location (Zv9):
Chromosome Zv9_NA447 (position 7552)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150189.1 7552
GRCz11 KN150189.1 7552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCTGCAGGGCACTGTTCAGTTGTCAGCCGATGGCTGCTGCCATGTTT[G/A]TGAGTATAATCTAAGAGAGAAACAATTTGGCTTTTTGTTCATTTAAATGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link