TMEM200C (2 of 2)

Ensembl ID:
ENSDARG00000089006
Description:
transmembrane protein 200C [Source:HGNC Symbol;Acc:37208]
Human Orthologue:
TMEM200C
Human Description:
transmembrane protein 200C [Source:HGNC Symbol;Acc:37208]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44552 Nonsense Mutation detected in F1 DNA During 2018
sa33064 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128028 Nonsense 206 374 1 2
Genomic Location (Zv9):
Chromosome 2 (position 58959593)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58017225
GRCz11 2 58639060
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAAAACACGACGCCGAGAAACTCAGGAAAGCAGCGGCGCCTGTCGTG[C/A]GCCAGAAACAGCTTTGGGTGAGTTACTCTTTACATCATTAAAGGGGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128028 Nonsense 346 374 2 2
Genomic Location (Zv9):
Chromosome 2 (position 58966572)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 58024204
GRCz11 2 58632081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCAGCCGGAGCCCGTGGGGAGACGCCCGCGCGCAGGTTCAGCTGCCCT[C/T]GACTGGAGCGCTGCAGCAGCAGGAGATACAACAAACTAGCAGAGCTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link