
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-207e14.4
- Ensembl ID:
- ENSDARG00000089004
- ZFIN ID:
- ZDB-GENE-030131-3405
- Human Orthologue:
- IL17RD
- Human Description:
- interleukin 17 receptor D [Source:HGNC Symbol;Acc:17616]
- Mouse Orthologue:
- Il17rd
- Mouse Description:
- interleukin 17 receptor D Gene [Source:MGI Symbol;Acc:MGI:2159727]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa15323 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa15323
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000128759 | Nonsense | 232 | 588 | 7 | 12 |
ENSDART00000132668 | Nonsense | 200 | 461 | 7 | 12 |
- Genomic Location (Zv9):
- Chromosome 23 (position 34326337)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 34088284 GRCz11 23 34014815 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACTGGCATCCCACATAWGTTGAGGTCCACCAGGAGAAMMGGGATGTTTA[T/A]GTGACCTTTAACCTTGCCYCTGAGAACTTTGGAGTTCATCAGTATTTTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: