zgc:171646

Ensembl ID:
ENSDARG00000089002
ZFIN ID:
ZDB-GENE-071004-16
Description:
ubiquitin-conjugating enzyme E2 E1 [Source:RefSeq peptide;Acc:NP_001096586]
Human Orthologues:
UBE2E1, UBE2E2
Human Descriptions:
ubiquitin-conjugating enzyme E2E 1 (UBC4/5 homolog, yeast) [Source:HGNC Symbol;Acc:12477]
ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) [Source:HGNC Symbol;Acc:12478]
Mouse Orthologues:
Ube2e1, Ube2e2
Mouse Descriptions:
ubiquitin-conjugating enzyme E2E 1, UBC4/5 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:107411]
ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast) Gene [Source:MGI Symbol;Acc:MGI:2384997]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10112 Essential Splice Site Available for shipment Available now
sa3002 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa10112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123519 Essential Splice Site None 195 1 6
Genomic Location (Zv9):
Chromosome 19 (position 19345721)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17899239
GRCz11 19 17359097
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGTGTTAAAGGTCAAACACGCGCCAGTAGTTGATACATCGACACGG[T/C]AACATTTATATTACCTACCATTTCGTCGATACAGCGAAACATTGTTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3002
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123519 Essential Splice Site 164 195 5 6
Genomic Location (Zv9):
Chromosome 19 (position 19361421)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 17914939
GRCz11 19 17373510
KASP Assay ID:
554-2469.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAAGTGCTACTGTCTATCTGCTCTCTGCTCACAGACTGTAACCCTGG[T/A]AAGTCACACGTCCGTAAACACACTTCAAGCTAATCAGGACTTGTTAGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link