AZI1 (2 of 2)

Ensembl ID:
ENSDARG00000088984
Description:
5-azacytidine induced 1 [Source:HGNC Symbol;Acc:29511]
Human Orthologue:
AZI1
Human Description:
5-azacytidine induced 1 [Source:HGNC Symbol;Acc:29511]
Mouse Orthologue:
Azi1
Mouse Description:
5-azacytidine induced gene 1 Gene [Source:MGI Symbol;Acc:MGI:107440]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44773 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44773
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085662 Nonsense 604 778 15 19
ENSDART00000129888 Nonsense 601 1102 14 25
Genomic Location (Zv9):
Chromosome 12 (position 37794385)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 36171499
GRCz11 12 35865754
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAACTAACTGTCAGAGACTAATGTAAAGGTAAATGTGTGTCTTTAGGCC[C/T]AGCAGAGGGAGCTGACGATCCGACACGTGAAGGAGACAGAGAAAGAGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link