Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-250k10.2
- Ensembl ID:
- ENSDARG00000088970
- ZFIN ID:
- ZDB-GENE-081104-7
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa25283 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25283
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000108559 | None | 515 | None | 1 | |
| ENSDART00000130247 | Nonsense | 865 | 1012 | 11 | 11 |
- Genomic Location (Zv9):
- Chromosome 4 (position 42207926)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 4 51398398 GRCz11 4 53328600 - KASP Assay ID:
- 554-7397.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACACACTCAACTCATTCTGTCTGAGGAGAACAGAGAGGTGAAGAGTGTG[A/T]GAGAGAATCAGCCGTATCCTGATCATCCAGACAGATTTGATGTTTATCTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
