si:dkey-250k10.2

Ensembl ID:
ENSDARG00000088970
ZFIN ID:
ZDB-GENE-081104-7

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25283 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108559   None 515 None 1
ENSDART00000130247 Nonsense 865 1012 11 11
Genomic Location (Zv9):
Chromosome 4 (position 42207926)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 51398398
GRCz11 4 53328600
KASP Assay ID:
554-7397.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACACTCAACTCATTCTGTCTGAGGAGAACAGAGAGGTGAAGAGTGTG[A/T]GAGAGAATCAGCCGTATCCTGATCATCCAGACAGATTTGATGTTTATCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link