si:dkey-259j3.6

Ensembl ID:
ENSDARG00000088937
ZFIN ID:
ZDB-GENE-091118-119
Human Orthologue:
GPR64
Human Description:
G protein-coupled receptor 64 [Source:HGNC Symbol;Acc:4516]
Mouse Orthologue:
Gpr64
Mouse Description:
G protein-coupled receptor 64 Gene [Source:MGI Symbol;Acc:MGI:2446854]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11602 Essential Splice Site Available for shipment Available now
sa18436 Nonsense Available for shipment Available now
sa41703 Nonsense Mutation detected in F1 DNA During 2018
sa4382 Essential Splice Site F2 line generated During 2018
sa15869 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123936 Essential Splice Site 17 1356 1 36
ENSDART00000131350   None 720 None 14

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36353388)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35386090
GRCz11 10 35329950
KASP Assay ID:
2260-3497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTYCTACAGATCATGTTAAAAATCACAGCATGAAACTGTCCACAAG[G/A]TATGTCATTTTRTGTTTATATGATTGWCTATATGTAAATGTGATGGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18436
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123936 Nonsense 425 1356 13 36
ENSDART00000131350   None 720 None 14
Genomic Location (Zv9):
Chromosome 10 (position 36366355)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35399057
GRCz11 10 35342917
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGTGATGATGATGAACTCGGCYGACATCGAAATCAGTGTGGAGGGA[C/T]AAATAGAAAGAGTGGGTTAGTGAAATACTACTAAAATTGTCTTTCGGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41703
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123936 Nonsense 461 1356 14 36
ENSDART00000131350   None 720 None 14
Genomic Location (Zv9):
Chromosome 10 (position 36366697)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35399399
GRCz11 10 35343259
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATAAATGTGATCAGACTCTCAATATTGATGTATGCAGCACACAACCA[C/T]AGAACATCTCATGGTAGGTTTAGACTAAAAACATGAAGTATCATGTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4382
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123936 Essential Splice Site 535 1356 18 36
ENSDART00000131350   None 720 None 14
Genomic Location (Zv9):
Chromosome 10 (position 36368959)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35401661
GRCz11 10 35345521
KASP Assay ID:
554-3523.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCTACAGGTTTCTCAATTGTTCAGTAATTCAACRTGCAGCGGCGCGTC[G/A]TAAGTTGTACCCTTTTTGTTGTGTTAGTTCACTGAAAGCAATCTAAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15869
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123936 Essential Splice Site 1019 1356 30 36
ENSDART00000131350 Essential Splice Site 418 720 9 14
Genomic Location (Zv9):
Chromosome 10 (position 36378307)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 35411009
GRCz11 10 35354869
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRTCGGCWATTTTCCTGTCTGTCACCCTGCTCACTTATCTGGCCTTTGGG[T/A]AAGAAAAATGCTTTGCAGGTTCAACATTCAATGCCTGAATTTTAGTATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link