si:dkey-240e12.6

Ensembl ID:
ENSDARG00000088932
ZFIN ID:
ZDB-GENE-050208-367
Description:
hypothetical protein LOC557168 [Source:RefSeq peptide;Acc:NP_001082844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1453 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa1453
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113186 Nonsense 7 137 1 6
Genomic Location (Zv9):
Chromosome 22 (position 25832870)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25332776
GRCz11 22 25352673
KASP Assay ID:
554-1379.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATGCATAGTGGAAGACAACAGCAGAACCATGGGCTTTCTCAGTTTTTG[T/A]CTTACCTGTGAGTTTCTTGTTGGGTTTAACAAGCAGATGTGCAGTAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link