si:rp71-68g1.1

Ensembl ID:
ENSDARG00000088891
ZFIN ID:
ZDB-GENE-070912-714
Human Orthologue:
SLC23A3
Human Description:
solute carrier family 23 (nucleobase transporters), member 3 [Source:HGNC Symbol;Acc:20601]
Mouse Orthologue:
Slc23a3
Mouse Description:
solute carrier family 23 (nucleobase transporters), member 3 Gene [Source:MGI Symbol;Acc:MGI:104516]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21432 Nonsense Available for shipment Available now
sa27338 Essential Splice Site Mutation detected in F1 DNA During 2018
sa41354 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa21432
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125054 Nonsense 88 582 3 12
ENSDART00000132392   None 61 None 1
ENSDART00000144003   None 292 None 5
ENSDART00000145456   19 32 2 2
Genomic Location (Zv9):
Chromosome 9 (position 7435785)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7415878
GRCz11 9 7394269
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCAGTTGTGGCGTTAAATGAAATGTTTCTTGTGCTCTCAGTTTGCCAT[T/A]GATTCAGGCTCCATCTTTGGACTTTCTGATCCCGGCCATGGCCTTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125054 Essential Splice Site 463 582 10 12
ENSDART00000132392   None 61 None 1
ENSDART00000144003 Essential Splice Site 173 292 3 5
ENSDART00000145456   None 32 None 2
Genomic Location (Zv9):
Chromosome 9 (position 7416336)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7396429
GRCz11 9 7374820
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTAGCACTGCCGCACTGGTTCAGACTTCACTCTGGATTTATACAAACAG[G/A]TACCATTTCATGTGTGACGTGTTTTGTTACACTTAATTTAGATTTGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41354
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125054 Nonsense 476 582 11 12
ENSDART00000132392   None 61 None 1
ENSDART00000144003 Nonsense 186 292 4 5
ENSDART00000145456   None 32 None 2
Genomic Location (Zv9):
Chromosome 9 (position 7416201)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7396294
GRCz11 9 7374685
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGTGTCTTCAGGTGTTGGCAGTGTTGACGTTTTTCTTCAGTCTCTTT[T/G]AACCTTACCTGTTTTTCTTGTGGGAGTCTTGGCTTTTCTTCTAGAGCACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link