si:dkeyp-69b9.3

Ensembl ID:
ENSDARG00000088881
ZFIN ID:
ZDB-GENE-100922-275
Human Orthologue:
MYOCD
Human Description:
myocardin [Source:HGNC Symbol;Acc:16067]
Mouse Orthologue:
Myocd
Mouse Description:
myocardin Gene [Source:MGI Symbol;Acc:MGI:2137495]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14150 Nonsense Available for shipment Available now
sa42681 Nonsense Mutation detected in F1 DNA During 2018
sa31001 Nonsense Mutation detected in F1 DNA During 2018
sa44842 Nonsense Mutation detected in F1 DNA During 2018
sa36066 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122111 Nonsense 140 757 6 14
ENSDART00000145410 Nonsense 4 621 1 9
Genomic Location (Zv9):
Chromosome 16 (position 15268157)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13626616
GRCz11 16 13516736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATGTCTTTGAAGATGACAACTCCTCTTCTGCCTCTGCATCTCCCGAG[C/T]AACTCGGGATGCACCAATCTCCCGGCTTCTCCTYATCATCACCTGGGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122111 Nonsense 314 757 8 14
ENSDART00000145410 Nonsense 178 621 3 9
ENSDART00000122111 Nonsense 314 757 8 14
ENSDART00000145410 Nonsense 178 621 3 9
Genomic Location (Zv9):
Chromosome 16 (position 15265456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13623915
GRCz11 16 13514035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCATACTCGCACCTCTTGCAACAACAGCAGGTGTTCTTACAACTA[C/T]AAATTCTCAACCAGCAACAACAACTCCCTGTGACAAACAGGTAATCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31001
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122111 Nonsense 314 757 8 14
ENSDART00000145410 Nonsense 178 621 3 9
ENSDART00000122111 Nonsense 314 757 8 14
ENSDART00000145410 Nonsense 178 621 3 9
Genomic Location (Zv9):
Chromosome 16 (position 15265456)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13623915
GRCz11 16 13514035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCCTCATACTCGCACCTCTTGCAACAACAGCAGGTGTTCTTACAACTA[C/T]AAATTCTCAACCAGCAACAACAACTCCCTGTGACAAACAGGTAATCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44842
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122111 Nonsense 556 757 12 14
ENSDART00000145410 Nonsense 420 621 7 9
Genomic Location (Zv9):
Chromosome 16 (position 15261060)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13619519
GRCz11 16 13509639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATACATTTCTTTCTTTATTGTTATTCTTAATATTAGGTAAACTGCTG[T/A]CAGCTTTGTGATGCAATTGGGCAGGACTTTGATTTGCCAATGCAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36066
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122111 Essential Splice Site 617 757 None 14
ENSDART00000145410 Essential Splice Site 481 621 None 9
Genomic Location (Zv9):
Chromosome 16 (position 15257801)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 13616260
GRCz11 16 13506380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACATCTTTAACACTGAATTCACCATTAAATTATTTTGTTATCTTTTC[A/T]GATAACTCTTCGCTCGTCACAGACATCCAATCAGCCGCTCTCGTCGTCTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Testosterone levels: Genome-wide association study of circulating estradiol, testosterone, and sex hormone-binding globulin in postmenopausal women. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link