ZFHX2

Ensembl ID:
ENSDARG00000088880
Description:
zinc finger homeobox 2 [Source:HGNC Symbol;Acc:20152]
Human Orthologue:
ZFHX2
Human Description:
zinc finger homeobox 2 [Source:HGNC Symbol;Acc:20152]
Mouse Orthologue:
Zfhx2
Mouse Description:
zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24463 Nonsense Available for shipment Available now
sa37844 Nonsense Mutation detected in F1 DNA During 2018
sa11780 Nonsense Available for shipment Available now
sa11253 Nonsense Available for shipment Available now
sa12734 Nonsense Available for shipment Available now
sa11559 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24463
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 456 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14488801)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14440249
GRCz11 24 14584668
KASP Assay ID:
2261-8545.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTAGAGGAGGCCACCAAGTTGGCAGAAAGGAGTAAAGACATGGCAGTA[C/T]AATGCATAAAGGTTGAGCCTTGCGATCAGCAAATGTCACTAAGATCTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37844
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 786 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14487811)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14439259
GRCz11 24 14583678
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTACAACAGTCTTCCTCTCAGATGCAGAGGATGAATATGATGATGAA[C/T]AGAGTATGAAAAAGAAAAGGAGAAAAAGTGAGATTGCCAAGGAAGATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 940 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14487349)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14438797
GRCz11 24 14583216
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAACCACAGCTCTACAATATCTGTCTCCACCGCTAACAGGCCCTCTATA[C/T]AAAAAAGTCATTTGCTTGATGGTCTGGGATTAAGACCAACCACTGTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11253
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 1007 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14487147)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14438595
GRCz11 24 14583014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTAAGACTAGCACTGTGTACATGAGGGCAGCAGAAAAAGTTACAACAT[C/A]ACTCATAGAAAGGGAAAAGGAGAAGGAACGAGAAAAAGAGCAGGATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12734
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 1052 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14487011)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14438459
GRCz11 24 14582878
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTCTAGGACCATCATCCATGCTGACCAGCTTGATATTCTCTAYGGATG[T/A]TAWTTCAAAGATCCRAACCCAGGAAAACATGAAWTTGAACAAATATCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11559
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122689 Nonsense 1053 1529 4 5
Genomic Location (Zv9):
Chromosome 24 (position 14487008)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14438456
GRCz11 24 14582875
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGGACCATCATCCATGCTGACCAGCTTGATATTCTCTAYGGATGTTA[T/A]TTCAAAGATCCRAACCCAGGAAAACATGAAWTTGAACAAATATCTGAGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link