wu:fc01d11

Ensembl ID:
ENSDARG00000088874
ZFIN ID:
ZDB-GENE-030131-2238
Human Orthologue:
FASN
Human Description:
fatty acid synthase [Source:HGNC Symbol;Acc:3594]
Mouse Orthologue:
Fasn
Mouse Description:
fatty acid synthase Gene [Source:MGI Symbol;Acc:MGI:95485]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16541 Nonsense Available for shipment Available now
sa8950 Nonsense Mutation detected in F1 DNA During 2018
sa11216 Nonsense Available for shipment Available now
sa44170 Nonsense Mutation detected in F1 DNA During 2018
sa8717 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16541
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122088 Nonsense 31 1583 1 1
Genomic Location (Zv9):
Chromosome 24 (position 33757352)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32637279
GRCz11 24 32551922
KASP Assay ID:
2261-8908.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTTTGTATTTTGTGGGAATGGTRTTACCTATAGGGGAATGTGTAAA[C/T]AGCTGCTGAAAGAAGAACCTGTTTTTAGRAGCAAGGTCAAAGAGGTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8950
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122088 Nonsense 666 1583 1 1
Genomic Location (Zv9):
Chromosome 24 (position 33759257)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32639184
GRCz11 24 32553827
KASP Assay ID:
2261-8909.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTCTTGGAGCACATGGACATATCAGAGATYTGTGTTTCTTTAACAAT[C/T]AGAAGATTGACATTCACACTGAGAGCAGCTTCTCCAGGAGAATCAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122088 Nonsense 1033 1583 1 1
Genomic Location (Zv9):
Chromosome 24 (position 33760358)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32640285
GRCz11 24 32554928
KASP Assay ID:
2261-8910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGATCAGGGAGATACTSATTTGCATGTTACCAAACAYAACCARACAA[C/T]AGCAAAGTTTGAGCATCTTCTCGGCTGTTCGTGATTCAGCTCTGGTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122088 Nonsense 1331 1583 1 1
Genomic Location (Zv9):
Chromosome 24 (position 33761252)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32641179
GRCz11 24 32555822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCCACAGTGCTGCTGTTCTCCATGATGGGTTACTGGAAACCCTTGAT[C/T]GATCTCTTTTCCGGAAAGTCCTGCAACCTAAAGTCTGCGGTGCTCTTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122088 Nonsense 1401 1583 1 1
Genomic Location (Zv9):
Chromosome 24 (position 33761462)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32641389
GRCz11 24 32556032
KASP Assay ID:
2261-8911.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCTGGATAYTTTTTGCCACTACCGACGYAATATCGGACTTCCAGGA[C/T]AGTCTATCAATTGGGGTCCCCTTAAACTTGGCCTGCTAATGAACAAAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link