si:dkey-265e15.4

Ensembl ID:
ENSDARG00000088870
ZFIN ID:
ZDB-GENE-081103-18
Description:
hypothetical protein LOC560232 [Source:RefSeq peptide;Acc:NP_001116726]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33493 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33493
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004188 Nonsense 536 838 6 9
ENSDART00000099538 Nonsense 716 827 9 10
ENSDART00000135420   None 725 None 4
Genomic Location (Zv9):
Chromosome 4 (position 29458892)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 30199360
GRCz11 4 30153884
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCACTGTTAATGTAATCTGTGTTCTTCTTTCTCAGATTGGCCATGTG[T/A]AAACTCACTGTTCAGTGTTGTGAGAGTTTGTCTTCAGCTCTACAATCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link