APEH (2 of 3)

Ensembl ID:
ENSDARG00000088860
Description:
N-acylaminoacyl-peptide hydrolase [Source:HGNC Symbol;Acc:586]
Human Orthologue:
APEH
Human Description:
N-acylaminoacyl-peptide hydrolase [Source:HGNC Symbol;Acc:586]
Mouse Orthologue:
Apeh
Mouse Description:
acylpeptide hydrolase Gene [Source:MGI Symbol;Acc:MGI:88041]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41318 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41318
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121931 Essential Splice Site 38 205 3 6
Genomic Location (Zv9):
Chromosome 8 (position 55856319)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 53911383
GRCz11 8 53741103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATAGCAAAATAATTGAGTTCTAATGGACCTGTCTGCTGTCCTGTGGTCA[G/A]TTTGCGGTGGACAGTGTTTTGAAGCAAGGCGGCTTTGATGAGCAGAAAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link