si:dkey-8o9.2

Ensembl ID:
ENSDARG00000088854
ZFIN ID:
ZDB-GENE-081103-17

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31405 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123747 Essential Splice Site 663 721 3 4
ENSDART00000140773   None 659 None 2
Genomic Location (Zv9):
Chromosome 4 (position 42383688)
Other Location(s):
Assembly Chromosome Position
GRCz11 4 53152838
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTCTCTGATGGACTGAAGAGTCAAAACTGTAAACTGGACACAATGAG[G/A]TCGGAGTTTAAACGCCTGATTGATTGATTGATTGATTGATTGATTGATTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link