si:dkey-81j8.6

Ensembl ID:
ENSDARG00000088831
ZFIN ID:
ZDB-GENE-091116-12
Human Orthologue:
SLK
Human Description:
STE20-like kinase [Source:HGNC Symbol;Acc:11088]
Mouse Orthologue:
Slk
Mouse Description:
STE20-like kinase (yeast) Gene [Source:MGI Symbol;Acc:MGI:103241]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41641 Nonsense Mutation detected in F1 DNA During 2018
sa21714 Nonsense Available for shipment Available now
sa21715 Nonsense Available for shipment Available now
sa31778 Nonsense Available for shipment Available now
sa18421 Splice Site, Nonsense Available for shipment Available now
sa34886 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41641
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Nonsense 101 1293 2 17
ENSDART00000140141 Nonsense 101 693 2 15
Genomic Location (Zv9):
Chromosome 10 (position 20693086)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20654500
GRCz11 10 20611881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCTGTCGACATCCGAACATCCTCTCCCTGCTGGACGCCATCTTCTTT[G/T]AGGGCTGGCTCTGGGTGAGAAATCTGTTTCCTTGTGTTTGTTTTGCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21714
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Nonsense 299 1293 7 17
ENSDART00000140141 Nonsense 299 693 7 15
Genomic Location (Zv9):
Chromosome 10 (position 20696133)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20657547
GRCz11 10 20614928
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACCCAGCAGCTCATGGCTCACCCCTTCTCTTATGCTGGACGAGATGGA[C/T]GAGCCCTAAAAGAGCTCATCGCTGAGGCCAAAGCAGAGGTCACTGAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21715
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Nonsense 342 1293 8 17
ENSDART00000140141   None 693 None 15
Genomic Location (Zv9):
Chromosome 10 (position 20698400)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20659814
GRCz11 10 20617195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCCTCCGTGGAAGACACAATCACCACAGAATCCGAGAAAACACTGCCA[C/T]GACCAGAACAAGCAATAGAAGAACAGGGACCACAAGAACCTGAGACCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31778
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Nonsense 922 1293 9 17
ENSDART00000140141 Nonsense 361 693 8 15
Genomic Location (Zv9):
Chromosome 10 (position 20700231)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20661645
GRCz11 10 20619026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCCAAAGTGGTTAGCGAGGGAGACAGCAAAGAAAAACTAATGCGCTA[C/A]AACAGGTAACAAGTCTTTATGCTTTACACCAGGGGTGTCCAAACTCGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18421
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Splice Site, Nonsense 924 1293 9 17
ENSDART00000140141 Splice Site, Nonsense 363 693 8 15
Genomic Location (Zv9):
Chromosome 10 (position 20700235)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20661649
GRCz11 10 20619030
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAGTGGTTAGCGAGGGAGACAGCAAAGAAAAACTAATGCGCTAYAAC[A/T]GGTAACAAGTCTTTATGCTTTACACCARGGGTGTCCAAACTYGGTCCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127235 Nonsense 1168 1293 14 17
ENSDART00000140141 Nonsense 607 693 13 15
Genomic Location (Zv9):
Chromosome 10 (position 20706582)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20667996
GRCz11 10 20625377
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGAAAATGGAGCTGAGAAAGCAAGGTCTGAGCGGCCCTGAGCAGAGA[C/T]AACATCTCACACAGGTTTGGATGCAGAAACCTCAGTGTCAGAATAATGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Uterine fibroids: A genome-wide association study identifies three loci associated with susceptibility to uterine fibroids. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link