
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-57h10.1
- Ensembl ID:
- ENSDARG00000088753
- ZFIN ID:
- ZDB-GENE-060526-173
- Description:
- Uncharacterized protein C4orf22 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2AVJ0]
- Human Orthologue:
- C4orf22
- Human Description:
- chromosome 4 open reading frame 22 [Source:HGNC Symbol;Acc:28554]
- Mouse Orthologue:
- 1700007G11Rik
- Mouse Description:
- RIKEN cDNA 1700007G11 gene Gene [Source:MGI Symbol;Acc:MGI:1916571]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa44613 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa20494 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa44613
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097872 | Nonsense | 77 | 239 | 2 | 6 |
ENSDART00000131245 | Nonsense | 77 | 257 | 2 | 6 |
- Genomic Location (Zv9):
- Chromosome 5 (position 41171609)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 38965501 GRCz11 5 39565654 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACAAGAAAAGCAGCTGCCGAGGCCTCCAGGCTTGCTTCAGGAAGCCAA[C/T]AGAAGTAAGGTTTTTGTGTAGTGACCATGAAAAGGGGACAGATTTCAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20494
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000097872 | Essential Splice Site | 156 | 239 | 5 | 6 |
ENSDART00000131245 | Essential Splice Site | 156 | 258 | 5 | 6 |
- Genomic Location (Zv9):
- Chromosome 5 (position 41266566)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 39060458 GRCz11 5 39660611 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTTAATCTCTAAACAATTAGAAATGTATTAACCTCAACCTTTTCTTTCA[G/T]CTTCTACAACTGGAGGACGCAGAAGTCCAAACACAATAACAGCTCAAACT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: