si:dkeyp-27b10.2

Ensembl ID:
ENSDARG00000088750
ZFIN ID:
ZDB-GENE-050419-93
Description:
Novel protein similar to vertebrate otogelin (OTOG) [Source:UniProtKB/TrEMBL;Acc:Q1LXP4]
Human Orthologue:
C12orf64
Human Description:
chromosome 12 open reading frame 64 [Source:HGNC Symbol;Acc:26901]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2976 Nonsense F2 line generated During 2018
sa43033 Nonsense Mutation detected in F1 DNA During 2018
sa16038 Essential Splice Site Available for shipment Available now
sa23212 Nonsense Available for shipment Available now
sa9582 Nonsense Available for shipment Available now
sa45627 Essential Splice Site, Splice Site Mutation detected in F1 DNA During 2018
sa25051 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa2976
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804   None 706 None 18
ENSDART00000122151   None 669 None 17
ENSDART00000135822 Nonsense 264 510 6 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587   None 592 None 12
Genomic Location (Zv9):
Chromosome 18 (position 5287815)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6061605
GRCz11 18 6201970
KASP Assay ID:
554-3212.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTACCGTATACAGTGACCGTCATTACCACACATTTGATGGCCTGGAGTA[T/A]GATTATGTGAGCGACTGCCAGGTCAACCTGGTCAAGGTACATGCTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43033
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Nonsense 170 706 4 18
ENSDART00000122151 Nonsense 170 669 4 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587 Nonsense 332 592 7 12
Genomic Location (Zv9):
Chromosome 18 (position 5320989)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6094779
GRCz11 18 6235144
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGATCATGCAGCACTCAAATGTCCTCCTGGTAAAGAATACAAACCCTG[T/A]GTGAACACATGCAAGACGCGAACATGCCAGAACCGCGATTACTATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Essential Splice Site 290 706 5 18
ENSDART00000122151 Essential Splice Site 290 669 5 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587 Essential Splice Site 452 592 8 12
Genomic Location (Zv9):
Chromosome 18 (position 5322602)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6096392
GRCz11 18 6236757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCCGTGGAYGTCCTGGAGGAAGGAGTCTGCTGTCCCAAGAAGWTCTGTG[G/A]TACAAAMATACAAACAYACAAATCCATCAGAAACAGGTCATCACCCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Nonsense 297 706 6 18
ENSDART00000122151 Nonsense 297 669 6 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587 Nonsense 459 592 9 12
Genomic Location (Zv9):
Chromosome 18 (position 5324171)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6097961
GRCz11 18 6238326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTACTGCATGTGTGTGTATTTTTGTTCAGAATGTAACCTGACCATCTG[T/A]CAGAGTGAAGTTCCCAGCTGTGAGAATGGAGACAAGCTGGTGATCGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9582
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Nonsense 390 706 8 18
ENSDART00000122151 Nonsense 390 669 8 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587 Nonsense 551 592 11 12
Genomic Location (Zv9):
Chromosome 18 (position 5325367)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6099157
GRCz11 18 6239522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAKACTGGAGAGATACTGGCTGTGGATATGAACACCACCAATCACTGCTG[T/A]CCACAGTATCATTGCGGTAGTTATAAGCACTCACTGGAMAGGACTACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45627
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Essential Splice Site 476 706 12 18
ENSDART00000122151 Splice Site 438 669 11 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   17 245 1 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587   None 592 None 12
Genomic Location (Zv9):
Chromosome 18 (position 5328652)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6102442
GRCz11 18 6242807
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGTGTGTGTGTAGTGAAGGCAGAAGTGTGTCTGTTTCAGGGTGTGAC[G/A]ATATTGAACCCTGGCCAGTCTATGGTGCAGTATTTTGAGGGGGAACTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25051
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092804 Essential Splice Site 558 706 13 18
ENSDART00000122151 Essential Splice Site 521 669 12 17
ENSDART00000135822   None 510 None 12
ENSDART00000136524   None 245 None 6
ENSDART00000139768   None 199 None 4
ENSDART00000140587   None 592 None 12
Genomic Location (Zv9):
Chromosome 18 (position 5331312)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 6105102
GRCz11 18 6245467
KASP Assay ID:
554-7730.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCTCCTGCTCATATCCCAGTGAAAACGGCACTACAGAAGTATTTATG[G/T]TAATCTGCACTCACCTTCTGCAAAAATATATTAAAGTTTCCCCTTGAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link