wu:fc21h01

Ensembl ID:
ENSDARG00000088744
ZFIN ID:
ZDB-GENE-030131-2932
Description:
Wu:fc21h01 protein [Source:UniProtKB/TrEMBL;Acc:Q6PHE0]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1382 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124930 Essential Splice Site 228 505 4 10
Genomic Location (Zv9):
Chromosome 23 (position 42991653)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42359306
GRCz11 23 42324802
KASP Assay ID:
554-1294.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATCATAAAAGAAAACATCATTCAGGCAGGATCACTTGTTGGACAGG[T/A]ATGGAAAGATGACAAATATTTCACAAGATGTCCAAACTGATCCTATAGTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link