ARHGAP6

Ensembl ID:
ENSDARG00000088730
Description:
Rho GTPase activating protein 6 [Source:HGNC Symbol;Acc:676]
Human Orthologue:
ARHGAP6
Human Description:
Rho GTPase activating protein 6 [Source:HGNC Symbol;Acc:676]
Mouse Orthologue:
Arhgap6
Mouse Description:
Rho GTPase activating protein 6 Gene [Source:MGI Symbol;Acc:MGI:1196332]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38181 Nonsense Mutation detected in F1 DNA During 2018
sa38180 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa38181
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128142 Nonsense 134 635 3 12
Genomic Location (Zv9):
Chromosome Zv9_NA290 (position 51546)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149984.1 51546
GRCz11 KN149984.1 51546
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCCCTCAGCTCATCCTCAGAAACACACACTGACAACAACAACACACCA[C/T]AAACACCAGAGACGGCGCTGCGCTCCAGACGACGGGTACAGCAACTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128142 Nonsense 605 635 12 12
Genomic Location (Zv9):
Chromosome Zv9_NA290 (position 33552)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149984.1 33552
GRCz11 KN149984.1 33552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACGGTGCTCAGGGTTCGTCTTCACATATCACAGTGTCTTCAAAAAGCT[T/A]GGATCAGCATCCAGAGTGGACCAGCGAGAGATGGCAGATCTGGAAACTTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link