tlr20al

Ensembl ID:
ENSDARG00000088701
ZFIN ID:
ZDB-GENE-071002-1
Description:
Toll-like receptor 20a [Source:UniProtKB/TrEMBL;Acc:B3DKB1]
Mouse Orthologues:
Tlr11, Tlr12
Mouse Descriptions:
toll-like receptor 11 Gene [Source:MGI Symbol;Acc:MGI:3045226]
toll-like receptor 12 Gene [Source:MGI Symbol;Acc:MGI:3045221]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41430 Essential Splice Site Mutation detected in F1 DNA During 2018
sa34658 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124265 Essential Splice Site 613 973 12 13
ENSDART00000142656   None 176 None 1
Genomic Location (Zv9):
Chromosome 9 (position 28412005)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27567701
GRCz11 9 27378447
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATTTGAGTAATGTTTTCATTAGTTCAGGACTGAGACCAATGCATCTT[G/T]TGATTGGGAGTAATACCACACTGAATAATGGGCTAAACTTGCACATCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34658
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124265 Essential Splice Site 614 973 13 13
ENSDART00000142656   None 176 None 1
Genomic Location (Zv9):
Chromosome 9 (position 28412195)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 27567891
GRCz11 9 27378637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATGAATTCATTGGGAAATATGTGCCATCAGTCGTCAGTCTGGAATTTC[A/T]GTCAATGTTCGCTGACAATATTGGAGACTTGTCTGTAATCAATCAGCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link