si:dkeyp-73e12.6

Ensembl ID:
ENSDARG00000088654
ZFIN ID:
ZDB-GENE-091204-395
Human Orthologue:
TEX15
Human Description:
testis expressed 15 [Source:HGNC Symbol;Acc:11738]
Mouse Orthologue:
Tex15
Mouse Description:
testis expressed gene 15 Gene [Source:MGI Symbol;Acc:MGI:1934816]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41586 Nonsense Mutation detected in F1 DNA During 2018
sa11305 Nonsense Available for shipment Available now
sa21645 Nonsense Available for shipment Available now
sa21646 Nonsense Mutation detected in F1 DNA During 2018
sa34830 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41586
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 127 2152 3 8
ENSDART00000133104   None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6176058)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7619225
GRCz11 10 7577925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGATTCTGCTTTTTAGCGGCAACAGATCAAATGACGACCCAGATTTA[T/A]CAGCATGGTCTGCCGGTTGGCAGCACAACACAGCATGCCTTGGGAAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 488 2152 6 8
ENSDART00000133104   None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6180010)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7623177
GRCz11 10 7581877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTAGCRAATGATSAAAGTGCGCATGCCCCAATATTRCCTTCAATGAGGT[T/A]ATTCAAATTAAAATTCCAGAAATATGCTGCCTATTTCAAAATGAAYGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 1102 2152 6 8
ENSDART00000133104   None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6181851)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7625018
GRCz11 10 7583718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGAGAAGGAAACAAAAGATTTCACTTCACGAGTAATGGTGGATAAA[G/T]AAGAACAAATGGCGACTAAAAGCAGCTCAAATCAAAATAAAGTATGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 1787 2152 6 8
ENSDART00000133104   None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6183907)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7627074
GRCz11 10 7585774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCTGGAAAAGGTTCACAAAGTTATAATGACTTTTGTGGAAACACCAT[C/A]AGATCAGTTGCCAGGGACATTTGATGTGGGGAAAGCGGAGCATCTGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125799 Nonsense 2107 2152 8 8
ENSDART00000133104   None 259 None 3
Genomic Location (Zv9):
Chromosome 10 (position 6187040)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 7630207
GRCz11 10 7588907
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCAAACTGTAATGTAAATCAAAATTTGGTATCTTCTCCTCTCTCAGTC[C/T]AGGCTTTGACTCATGTTCCTGTGCCCAACACGATTACAACAATTCAATAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link