cdca9

Ensembl ID:
ENSDARG00000088639
ZFIN ID:
ZDB-GENE-090706-4
Description:
Borealin-2 [Source:UniProtKB/Swiss-Prot;Acc:P86347]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31875 Nonsense Available for shipment Available now
sa17307 Essential Splice Site Available for shipment Available now
sa42029 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31875
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123808 Nonsense 25 255 1 10
Genomic Location (Zv9):
Chromosome 12 (position 24023468)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22553034
GRCz11 12 22674253
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGAGTCAGGATTCAGACGGTCAGGTCGACGACCAGCAGAGCTTTGAG[C/T]AGAAGATCAGACTCACCAAGAGAAAAGAGCTCTTCATACAACAGTTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17307
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123808 Essential Splice Site 44 255 1 10
Genomic Location (Zv9):
Chromosome 12 (position 24023527)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22553093
GRCz11 12 22674312
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACTCACCAAGAGAAAAGAGCTCTTCATACAACAGTTTGAGAAGGAAGG[T/C]CAGTCATTAAGCCAATACCSTTTTCCAGATTTTCTSTGGGTTCTTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123808 Nonsense 182 255 7 10
Genomic Location (Zv9):
Chromosome 12 (position 24027287)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22556805
GRCz11 12 22678024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAAAGAACTCAAGGACGGGTTGTCAAACTCAGTGACCAAGCAAATGCTT[T/A]AGGGGTTCAATTTAGGTAACATTTCCTTTCTTGAGTGTTATACTGGTGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link