Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tmem104
- Ensembl ID:
- ENSDARG00000088560
- ZFIN ID:
- ZDB-GENE-070822-4
- Human Orthologue:
- TMEM104
- Human Description:
- transmembrane protein 104 [Source:HGNC Symbol;Acc:25984]
- Mouse Orthologue:
- Tmem104
- Mouse Description:
- transmembrane protein 104 Gene [Source:MGI Symbol;Acc:MGI:2444222]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa45137 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
| sa33135 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45137
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000128626 | Essential Splice Site | 143 | 496 | 6 | 10 |
| ENSDART00000133332 | Essential Splice Site | 143 | 217 | 7 | 9 |
| ENSDART00000148133 | Essential Splice Site | 12 | 362 | 4 | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18684831)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18713193 GRCz11 3 18862933 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGTAAAGCCATGAATCTTTAGAATGACACACATGTTGCTTCTTTCCACA[G/A]TTGGTGTCAATATGTTCTACATCTGCATCATCGTGTACCTGTATGGAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33135
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000128626 | Essential Splice Site | 212 | 496 | None | 10 |
| ENSDART00000133332 | None | 217 | None | 9 | |
| ENSDART00000148133 | Essential Splice Site | 78 | 362 | None | 7 |
- Genomic Location (Zv9):
- Chromosome 3 (position 18718822)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 3 18747184 GRCz11 3 18896924 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAACAAAACTGTTCCTTGTTTTCATTAACTTGTCTGTATTTTATTTTTC[A/T]GGCCATCTTCACATTGTTACTGGGACCCTTTACCTTTTTCAATGCTCAGA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
