tmem104

Ensembl ID:
ENSDARG00000088560
ZFIN ID:
ZDB-GENE-070822-4
Human Orthologue:
TMEM104
Human Description:
transmembrane protein 104 [Source:HGNC Symbol;Acc:25984]
Mouse Orthologue:
Tmem104
Mouse Description:
transmembrane protein 104 Gene [Source:MGI Symbol;Acc:MGI:2444222]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45137 Essential Splice Site Mutation detected in F1 DNA During 2018
sa33135 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45137
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128626 Essential Splice Site 143 496 6 10
ENSDART00000133332 Essential Splice Site 143 217 7 9
ENSDART00000148133 Essential Splice Site 12 362 4 7
Genomic Location (Zv9):
Chromosome 3 (position 18684831)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18713193
GRCz11 3 18862933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTAAAGCCATGAATCTTTAGAATGACACACATGTTGCTTCTTTCCACA[G/A]TTGGTGTCAATATGTTCTACATCTGCATCATCGTGTACCTGTATGGAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33135
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128626 Essential Splice Site 212 496 None 10
ENSDART00000133332   None 217 None 9
ENSDART00000148133 Essential Splice Site 78 362 None 7
Genomic Location (Zv9):
Chromosome 3 (position 18718822)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18747184
GRCz11 3 18896924
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAAAACTGTTCCTTGTTTTCATTAACTTGTCTGTATTTTATTTTTC[A/T]GGCCATCTTCACATTGTTACTGGGACCCTTTACCTTTTTCAATGCTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link